| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.113651 |
| Chromosome: | chromosome 10 |
| Location: | 4496209 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g451850 | KATL2 | (1 of 4) K07767 - katanin p60 ATPase-containing subunit A1 [EC:3.6.4.3] (KATNA1); Katanin like protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCTGTCCAGCACTGCTGCGACCACCGG |
| Internal bar code: | GTGAAAATAGTTAATAGTTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 822 |
| LEAP-Seq percent confirming: | 99.7818 |
| LEAP-Seq n confirming: | 1829 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGCGTCATTTCTCCTGT |
| Suggested primer 2: | CACAGCAACATAGCAGGGAA |