Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.113707 |
Chromosome: | chromosome 10 |
Location: | 1083977 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g425350 | (1 of 6) IPR001245//IPR011009 - Serine-threonine/tyrosine-protein kinase catalytic domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGAGCGCGCGCCAACCAACTGTGCCAA |
Internal bar code: | GTTACGATAGCACTCCGTACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 501 |
LEAP-Seq percent confirming: | 98.2548 |
LEAP-Seq n confirming: | 1126 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCCATCCAACGGGTCATA |
Suggested primer 2: | CTCGGACACATATCACACCG |