Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.113713 |
Chromosome: | chromosome 1 |
Location: | 3575116 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g022950 | (1 of 8) PTHR26379:SF144 - BTB/POZ DOMAIN-CONTAINING PROTEIN 19 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGCCTCCGGCTTCCTGCGTCCCACTAG |
Internal bar code: | GCGGTTCTGGCCCACCGCATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 435 |
LEAP-Seq percent confirming: | 63.8674 |
LEAP-Seq n confirming: | 2639 |
LEAP-Seq n nonconfirming: | 1493 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGGACCTGGAATACTTGCC |
Suggested primer 2: | AGAACTTCTTGCACCACGCT |