Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.113741 |
Chromosome: | chromosome 1 |
Location: | 1458217 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g007450 | (1 of 4) K15111 - solute carrier family 25 (mitochondrial S-adenosylmethionine transporter), member 26 (SLC25A26) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCATTTCGTCAATCCATTTGGAGAACC |
Internal bar code: | AGGCGTTGGCGATTTCAGTTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 158 |
LEAP-Seq percent confirming: | 99.655 |
LEAP-Seq n confirming: | 1733 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGATCGGTCGATAGGAAA |
Suggested primer 2: | GTGCATAGTTTGGGGCAGTT |