| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.113772 |
| Chromosome: | chromosome 16 |
| Location: | 1295944 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g651450 | (1 of 3) PTHR13367:SF8 - OTU DOMAIN-CONTAINING PROTEIN 7B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGCCATCTTCTGGAACTCGAACGGCA |
| Internal bar code: | AGACATGCCGGGTAATAGGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 21.5517 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 182 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATAGCGGTATGCCAGGT |
| Suggested primer 2: | CTTCTGGATCACACGCAAGA |