| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.113790 |
| Chromosome: | chromosome 3 |
| Location: | 2836389 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162400 | HEATR2B,HTR2B,DNAAF5 | (1 of 1) IPR011989//IPR016024//IPR021133 - Armadillo-like helical // Armadillo-type fold // HEAT, type 2; 5-Hydroxytryptamine Receptor 2B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCCTGACCCGGCCAAGCGGCGCGCACAC |
| Internal bar code: | TGATGAAGCTGCTGCTTACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 91 |
| LEAP-Seq percent confirming: | 99.8389 |
| LEAP-Seq n confirming: | 2479 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGTGGTTTGTTCCAATC |
| Suggested primer 2: | CAGGACCTCCACCACCAC |