| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.113899 |
| Chromosome: | chromosome 3 |
| Location: | 7573189 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204750 | (1 of 1) PF12928 - tRNA-splicing endonuclease subunit sen54 N-term (tRNA_int_end_N2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACAAGGCTGTGCGGTCCTTGAAGGAGT |
| Internal bar code: | CCACGCTTGACGATTGGCACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 744 |
| LEAP-Seq percent confirming: | 97.0617 |
| LEAP-Seq n confirming: | 2015 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGTGCAGCTCGTTACCA |
| Suggested primer 2: | GTCGCTGGCTTGTCTCCTAC |