Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.113918 |
Chromosome: | chromosome 2 |
Location: | 3336380 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095092 | PSY1 | Phytoene synthase; (1 of 1) K02291 - phytoene synthase (crtB) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGTAGCGGGCGCGGGGCAGCGTCCGC |
Internal bar code: | GGGCGAGTAACGGACTGCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 525 |
LEAP-Seq percent confirming: | 99.6732 |
LEAP-Seq n confirming: | 305 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCATACGAGCAGTGGAGA |
Suggested primer 2: | TGGACACACAGGCTTCTCAG |