| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.113934 |
| Chromosome: | chromosome 5 |
| Location: | 2559788 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236050 | (1 of 2) IPR015097 - Lung surfactant protein D coiled-coil trimerisation | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATTTTAAACCCCGCATGGGGAAGGGGAA |
| Internal bar code: | CCTACGCGACTTGGGCTCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 74 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGGAGCAGGCATTT |
| Suggested primer 2: | CTCTTCACCAGGTCCTGAGC |