Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.114009 |
Chromosome: | chromosome 12 |
Location: | 2149702 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508700 | ELG2 | Exostosin-like glycosyltransferase; (1 of 1) K02367 - glucuronyl/N-acetylglucosaminyl transferase EXT2 (EXT2) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATACATCCGCTGCTGGTTAAGTGCTTACT |
Internal bar code: | CACAGGTTCCACGCCGATCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 796 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1018 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCACATTAAGGTCCAAGCC |
Suggested primer 2: | TGTGATCAGCTTCCAGCAAC |