| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.114027 |
| Chromosome: | chromosome 2 |
| Location: | 8427970 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141626 | PRMT7 | Protein arginine N-methyltransferase; (1 of 1) K11438 - protein arginine N-methyltransferase 7 [EC:2.1.1.-] (PRMT7) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCAGCACACAACTGCGAAGGTGAGCGGT |
| Internal bar code: | CACCGGGGAGTTAGGGCGGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 671 |
| LEAP-Seq percent confirming: | 99.908 |
| LEAP-Seq n confirming: | 1086 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATGGTGATTCGGTAATCC |
| Suggested primer 2: | ACCCGTGAACTTGACTACGG |