Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.114097 |
Chromosome: | chromosome 2 |
Location: | 843287 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g078950 | MMP17 | Matrix metalloproteinase; (1 of 40) 3.4.24.38 - Gametolysin / Lysin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTACTGAATACCGAGCCGTTCACAGGTT |
Internal bar code: | CTTTAGGAGTCCCGGAACCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1093 |
LEAP-Seq percent confirming: | 99.784 |
LEAP-Seq n confirming: | 462 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCACACTCCTACAGCCAA |
Suggested primer 2: | CTGCCCATGTATGGCTTCTT |