| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.114168 |
| Chromosome: | chromosome 2 |
| Location: | 379966 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075900 | STK9,STPK9,SNRK2C | (1 of 1) IPR000719//IPR001245//IPR002290//IPR004223//IPR011009//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Vitamin B12-dependent methionine synthase, activation domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain; snRK1 family in Chlamydomonas, subgroup 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTGTTATCTTACAGTTCCAGTGATGCA |
| Internal bar code: | ACGGATGCATTTGATGGTGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 989 |
| LEAP-Seq percent confirming: | 99.6785 |
| LEAP-Seq n confirming: | 1860 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTCCACTACTCGGACGGG |
| Suggested primer 2: | GTGTGTCGCGTCCATGTATC |