| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.114227 |
| Chromosome: | chromosome 7 |
| Location: | 552015 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316450 | (1 of 1) IPR002625//IPR003892//IPR009060 - Smr domain // Ubiquitin system component Cue // UBA-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGTGATTGTGGGCAAGGGCCTGCACAG |
| Internal bar code: | GCGGTCATCGTACACGGAGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 456 |
| LEAP-Seq percent confirming: | 98.7952 |
| LEAP-Seq n confirming: | 328 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTGACAATCAGCACGTT |
| Suggested primer 2: | CATGTCCTACGTTCGCTCAA |