| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.114338 |
| Chromosome: | chromosome 12 |
| Location: | 2494400 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g506600 | LPN1,PAH1 | Putative phosphatidate phosphatase; (1 of 1) K15728 - phosphatidate phosphatase LPIN (LPIN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCTGCGGCCGCCGGCTTTGCTTCCCCC |
| Internal bar code: | TAACCTAGGCGCTATCTATTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 86.2898 |
| LEAP-Seq n confirming: | 1328 |
| LEAP-Seq n nonconfirming: | 211 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGCTTTCATTTTCCTCGC |
| Suggested primer 2: | GTCACACAATGACCGACTGG |