Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.114424 |
Chromosome: | chromosome 2 |
Location: | 7313972 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g145300 | (1 of 1) K15544 - RNA polymerase II subunit A C-terminal domain phosphatase SSU72 (SSU72) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAGTCCTCCCACTCGCCGCCCTGCTCC |
Internal bar code: | AGTAGAGGAACGGCGCTCGCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 323 |
LEAP-Seq percent confirming: | 99.6381 |
LEAP-Seq n confirming: | 3579 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTCCACCTCCTCATCCAT |
Suggested primer 2: | GGCGGTATCTGTGGCTATGT |