Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.114472 |
Chromosome: | chromosome 10 |
Location: | 1679913 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g430100 | ELG22 | Exostosin-like glycosyltransferase 22; (1 of 6) IPR000742//IPR004263//IPR009030 - EGF-like domain // Exostosin-like // Insulin-like growth factor binding protein, N-terminal | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCTGCTGGTCATAATCTCTGGCCGCCAG |
Internal bar code: | TGGTCAGTCGCGGCCACATGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 888 |
LEAP-Seq percent confirming: | 99.7909 |
LEAP-Seq n confirming: | 1432 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGTGCAGTGCAAAACAGT |
Suggested primer 2: | CATGCCCTGATGATTTGTTG |