| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.114483 |
| Chromosome: | chromosome 1 |
| Location: | 383146 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002350 | NAE1 | RUB1/NEDD8 E1 activating enzyme; (1 of 1) K04532 - amyloid beta precursor protein binding protein 1 (APPBP1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAAGGACGAAATGCCAAAGTCGAAGTT |
| Internal bar code: | CGCATACAGATAGACGGTGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 99.7761 |
| LEAP-Seq n confirming: | 2674 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTGGCCGAATTCCTTAAA |
| Suggested primer 2: | TACCAGGCCAAAGTAAACCG |