| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.114494 |
| Chromosome: | chromosome 4 |
| Location: | 304917 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217904 | mL118,MRPL118,OPR133 | mitochondrial ribosome protein mL118, Chlamydomonas-specific; (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATCCACCACCCCACCACTTCACCACGA |
| Internal bar code: | GGGTGAAGTGGCGCGCGTGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 76.5267 |
| LEAP-Seq n confirming: | 1604 |
| LEAP-Seq n nonconfirming: | 492 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAGCGTTAGGCTGGTTT |
| Suggested primer 2: | TGTCTCAGTGATGCTCCTGC |