Insertion junction: LMJ.RY0402.114528_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.114528
Chromosome:chromosome_12
Location:3577342
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g513650 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ATTACGGCTTCAACGCAACCAAGGCTGGAC
Internal bar code:GGAAGTAGGGGGACCAGGGAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:893
LEAP-Seq percent confirming:99.4681
LEAP-Seq n confirming:9538
LEAP-Seq n nonconfirming:51
LEAP-Seq n unique pos:47

Suggested primers for confirmation by PCR

Suggested primer 1:AGGAAAGTGGTGGAGGAGGT
Suggested primer 2:CCTAGGGATGTGCAGGTGTT