| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.114531 |
| Chromosome: | chromosome 3 |
| Location: | 1197480 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149600 | CYG53 | (1 of 3) PTHR11920//PTHR11920:SF328 - ADENYLATE AND GUANYLATE CYCLASES // SUBFAMILY NOT NAMED; Adenylate/guanylate cyclase | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTGGTCCTGTGCAGTGCACAGCCGAAC |
| Internal bar code: | GCCACTCAAGTCGAATGATACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 274 |
| LEAP-Seq percent confirming: | 99.9434 |
| LEAP-Seq n confirming: | 1766 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTGTGTGGGGTGTGTAG |
| Suggested primer 2: | TTCTGACGGGATGTGTGTGT |