Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.114619 |
Chromosome: | chromosome 6 |
Location: | 8032858 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g304150 | (1 of 4) PF06985//PF12796 - Heterokaryon incompatibility protein (HET) (HET) // Ankyrin repeats (3 copies) (Ank_2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCGAAGTCCGTGTGATAACAAGGCGTG |
Internal bar code: | GCGCTTGGGCCCGCGCCGCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 824 |
LEAP-Seq percent confirming: | 88.8298 |
LEAP-Seq n confirming: | 1670 |
LEAP-Seq n nonconfirming: | 210 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGTTGGTCACATGAATGG |
Suggested primer 2: | AGGTGTGGCTAAGATGTGGG |