| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.114638 |
| Chromosome: | chromosome 2 |
| Location: | 957994 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g079926 | PHC64 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAGCCTCCTAGGCAACGCTCGTGTCGC |
| Internal bar code: | CGGCGGAGGTGTCTCATCTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 492 |
| LEAP-Seq percent confirming: | 91.3587 |
| LEAP-Seq n confirming: | 15647 |
| LEAP-Seq n nonconfirming: | 1480 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACCCGTCTGTCAGGAAC |
| Suggested primer 2: | CAGTCAGACAGTGCAGGCAT |