Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.114679 |
Chromosome: | chromosome 5 |
Location: | 2216093 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234655 | (1 of 1) K17550 - protein phosphatase 1 regulatory subunit 7 (PPP1R7, SDS22) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGACTGATGCAACCACGGCGCCAACAAC |
Internal bar code: | GGGAAGTGAGTCGCAAATGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 791 |
LEAP-Seq percent confirming: | 99.9266 |
LEAP-Seq n confirming: | 2722 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTGTCCAAAGTCAATGC |
Suggested primer 2: | CACAGCCTCACCTGCATCTA |