| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.114699 |
| Chromosome: | chromosome 17 |
| Location: | 2985189 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720261 | (1 of 1) PTHR12482//PTHR12482:SF5 - UNCHARACTERIZED // PROTEIN C09D4.4, ISOFORM C | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCATGCTTAATCAAGAAGTGAAGGCGTA |
| Internal bar code: | ACTCGATGAGCGCATCGCATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 99.0954 |
| LEAP-Seq n confirming: | 2410 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACACACACACTGTGGCA |
| Suggested primer 2: | CTACCACAACGACCCCAACT |