Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.114723 |
Chromosome: | chromosome 7 |
Location: | 5014281 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g347050 | RSP7 | (1 of 1) PF02197//PF13499//PF13833 - Regulatory subunit of type II PKA R-subunit (RIIa) // EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8); Radial Spoke Protein 7 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAAGCGTTGCAAGCCACTGCTAAATAT |
Internal bar code: | GCTATTAGGAGGGAGTGTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1235 |
LEAP-Seq percent confirming: | 99.5235 |
LEAP-Seq n confirming: | 19217 |
LEAP-Seq n nonconfirming: | 92 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGAAGACCTGGGAAAGATG |
Suggested primer 2: | AGAGGCATGTGAGGAAATGG |