| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.114757 |
| Chromosome: | chromosome 3 |
| Location: | 2969790 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g163500 | EX1,CGLD21 | Executer 1, chloroplastic; (1 of 1) PTHR33917//PTHR33917:SF1 - FAMILY NOT NAMED // PROTEIN EXECUTER 1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAAGGGCATCTCGTGCCTCCTGCATCC |
| Internal bar code: | GATTTCGGGTTGCGACGTCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 92.9245 |
| LEAP-Seq n confirming: | 197 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCCTCATCCTGCTCAAC |
| Suggested primer 2: | ACAGGACTGACCCAAAGTCG |