| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.114846 |
| Chromosome: | chromosome 16 |
| Location: | 6411461 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673650 | CP26,LHCB5 | (1 of 1) K08916 - light-harvesting complex II chlorophyll a/b binding protein 5 (LHCB5); Light-harvesting minor chlorophyll a/b binding protein of photosystem II | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCAATTCGATCAGGCCCGAAGAAGCT |
| Internal bar code: | AGTTTTTGCTCCCGCGGGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1053 |
| LEAP-Seq percent confirming: | 99.7937 |
| LEAP-Seq n confirming: | 1935 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTTACAAAGCGACTCAA |
| Suggested primer 2: | ATGGAGTACGGACGATGGAG |