Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.114889 |
Chromosome: | chromosome 11 |
Location: | 47181 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467528 | CAV4 | (1 of 5) PTHR10037//PTHR10037:SF218 - VOLTAGE-GATED CATION CHANNEL CALCIUM AND SODIUM // SUBFAMILY NOT NAMED; Voltage-gated Ca2+ channel, alpha subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGTTGTCCATGCCGCTGCCTTAAGACT |
Internal bar code: | GACTACGGCTGACGGCCGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 405 |
LEAP-Seq percent confirming: | 95.935 |
LEAP-Seq n confirming: | 118 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTAGCTCCTAACCAGGCT |
Suggested primer 2: | GATGGTCCAAAACCAGCACT |