| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.115127 |
| Chromosome: | chromosome 3 |
| Location: | 6741409 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g198000 | PPP15 | (1 of 2) PF00481//PF13672 - Protein phosphatase 2C (PP2C) // Protein phosphatase 2C (PP2C_2); Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATTGCAGGCACATGGGGTTGCATGAAC |
| Internal bar code: | CCAACCGGTCACTGATTTCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1047 |
| LEAP-Seq percent confirming: | 99.2213 |
| LEAP-Seq n confirming: | 1529 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCTAGGACACGTTCACAT |
| Suggested primer 2: | TCTTCTTGACGCACACGAAC |