| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.115193 |
| Chromosome: | chromosome 11 |
| Location: | 2623065 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476376 | FAP221,Pcdp1,RPC82 | Flagellar Associated Protein 221; (1 of 1) PTHR23053//PTHR23053:SF21 - DLEC1 DELETED IN LUNG AND ESOPHAGEAL CANCER 1 // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCAGGCTGCCGTACGGGCTGTACGACG |
| Internal bar code: | CCAATCCTGGGGGGGTCACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 318 |
| LEAP-Seq percent confirming: | 99.6529 |
| LEAP-Seq n confirming: | 27558 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACCAGCCCAAACTGAACG |
| Suggested primer 2: | TAGCGGTAAAGGAGGGGTTT |