| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.115194 |
| Chromosome: | chromosome 1 |
| Location: | 4714296 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032500 | DNJ8,TPR2 | Tetratricopeptide-repeat protein 2; (1 of 1) K09523 - DnaJ homolog subfamily C member 3 (DNAJC3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTCGGCGCTGCATCCTCTCTCTCCCCGC |
| Internal bar code: | CAGCGCGAATCTTCGTCGTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 99.7622 |
| LEAP-Seq n confirming: | 839 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTTACCCCCTGACCCTC |
| Suggested primer 2: | AACATGCAAGGGTGTCACAA |