| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.115266 |
| Chromosome: | chromosome 8 |
| Location: | 2178184 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g369600 | MFT2,MAE2,MFT2 | MATE efflux family protein; (1 of 1) IPR000104//IPR002528//IPR029303 - Antifreeze protein, type I // Multi antimicrobial extrusion protein // Polysaccharide biosynthesis protein, C-terminal domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGTGCGTGGGGCTCTGCTTCATTGCCA |
| Internal bar code: | GGTGGAGTAAAAGGACGCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 625 |
| LEAP-Seq percent confirming: | 99.8191 |
| LEAP-Seq n confirming: | 2207 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGGTCTGGTGTGGGTCT |
| Suggested primer 2: | AGGTTGACTGCCGTGCTACT |