| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.115276 |
| Chromosome: | chromosome 6 |
| Location: | 6254668 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291050 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATTTACAACCCTCCTTCCCCCCCCCCCA |
| Internal bar code: | AAGCCTGTGTTGAAAAATTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 365 |
| LEAP-Seq percent confirming: | 99.7494 |
| LEAP-Seq n confirming: | 398 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGGCCACATACACATC |
| Suggested primer 2: | GTCAGCCTTGCACGACAATA |