| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.115366 |
| Chromosome: | chromosome 9 |
| Location: | 2258934 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392650 | MOT39 | Predicted protein; (1 of 1) PTHR14991//PTHR14991:SF0 - FAMILY NOT NAMED // RING FINGER PROTEIN 32 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATCATATCCCTCCATCCGCCCAACTGGC |
| Internal bar code: | GGCCCTCGATGTAGGATATCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 94.8186 |
| LEAP-Seq n confirming: | 732 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGTCTTGCTGGTCTTGC |
| Suggested primer 2: | AAGCAAACAATCCCCAACAG |