Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.115408 |
Chromosome: | chromosome 15 |
Location: | 1725595 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g643703 | RLS9 | (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1); RegA/Rls-like protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCATCTGCACGTGCGAAGAGGGAAGGGG |
Internal bar code: | CTTGTTGGCTGGTGGGGTGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 58 |
LEAP-Seq percent confirming: | 97.9592 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCCCACACACCTATTACT |
Suggested primer 2: | ACCGGTGAAGAAATACGCAC |