Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.115445 |
Chromosome: | chromosome 7 |
Location: | 3658387 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g337300 | DSK2,DYRK2,DYRKP1,DYRKP,STD1 | Dual-Specificity Tyrosine-Regulated Protein Kinase involved in starch degradation; (1 of 2) PTHR24058//PTHR24058:SF23 - DUAL SPECIFICITY PROTEIN KINASE // SERINE/THREONINE KINASE-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCACGCGAGTGACGTGCGAGTCCTGTT |
Internal bar code: | AAAGGCGGTCGTCACAAACGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 618 |
LEAP-Seq percent confirming: | 99.8557 |
LEAP-Seq n confirming: | 2076 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAAGGCTTGACAACAACT |
Suggested primer 2: | ACCGCGAGGTATTGTACTGG |