Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.115551 |
Chromosome: | chromosome 10 |
Location: | 4290362 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g450700 | CSB329,TNP26 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAAAAAAGTATATATAGCTAGGCCGTA |
Internal bar code: | TATCCTACAGCGAATAACGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 375 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 289 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTGCCTAGCAATATCACA |
Suggested primer 2: | GGAACAACTCCTCATCCAGC |