| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.115591 |
| Chromosome: | chromosome 2 |
| Location: | 2382011 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091150 | SEC24A | (1 of 1) PTHR13803//PTHR13803:SF11 - SEC24-RELATED PROTEIN // SUBFAMILY NOT NAMED; COP-II coat subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGACTCGTCCCCTGGCGCGCCTCACACA |
| Internal bar code: | CCTGGCCCGTGCGGCGAGATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 273 |
| LEAP-Seq percent confirming: | 99.689 |
| LEAP-Seq n confirming: | 641 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCTCCCTCTCTCTCTT |
| Suggested primer 2: | CACTGTACAGGCAGCCATTG |