| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.115622 |
| Chromosome: | chromosome 16 |
| Location: | 5991433 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676600 | (1 of 4) IPR029041 - FAD-linked oxidoreductase-like | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGGCTAGCAGACATGCCAACAGAGTGTA |
| Internal bar code: | TACGCAAGTAAACGTTGAACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 99.5632 |
| LEAP-Seq n confirming: | 5699 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCAGGGTTAGTGTCCATCC |
| Suggested primer 2: | CTCAGCCCATACAACCCAGT |