| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.115631 |
| Chromosome: | chromosome 16 |
| Location: | 3819738 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689700 | HPR5 | (1 of 1) 1.1.1.272 - D-2-hydroxyacid dehydrogenase (NADP(+)); Hydroxypyruvate reductase 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGCTTCCGCGGCGGCGGGGGTAGCTGG |
| Internal bar code: | ATACGGGACCTGGGAGAAGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 896 |
| LEAP-Seq percent confirming: | 98.7597 |
| LEAP-Seq n confirming: | 2787 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCGACTATGTGGTGATG |
| Suggested primer 2: | CCGAGTCGGAACAGTACCAT |