| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.115635 |
| Chromosome: | chromosome 3 |
| Location: | 6751587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g198100 | BET1 | ER-to-Golgi Qc-SNARE protein, Bet1/mBET1 family (Qc.II); (1 of 1) K08504 - blocked early in transport 1 (BET1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGATTATGGCCGCACGCGTGTCGCTAG |
| Internal bar code: | AGGGCTCGCTAGTGAAGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 97.3048 |
| LEAP-Seq n confirming: | 2094 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACAAGAAGCAGGCATGTA |
| Suggested primer 2: | CAAAGTTGGCATAGTCCCGT |