| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.115643 |
| Chromosome: | chromosome 9 |
| Location: | 2521359 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391000 | GT90F14,GT90-14 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 14 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCACGTTGACTCTGTGCTTTAGCAGCCT |
| Internal bar code: | ATAGGCATCTCGGTATCCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 98.7662 |
| LEAP-Seq n confirming: | 11127 |
| LEAP-Seq n nonconfirming: | 139 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTATTTCCCACCTCAACCG |
| Suggested primer 2: | TTCCCTGTCAGGTAGGTTGC |