Insertion junction: LMJ.RY0402.115655_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.115655
Chromosome:chromosome_10
Location:1644403
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TCGGCTGCGAACAGGGACTCCAGGCTGCGG
Internal bar code:GGGGGGTGTGGAGCGATCCGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:752
LEAP-Seq percent confirming:94.468
LEAP-Seq n confirming:11117
LEAP-Seq n nonconfirming:651
LEAP-Seq n unique pos:37

Suggested primers for confirmation by PCR

Suggested primer 1:CTGGAGGTGCATGAGGAACT
Suggested primer 2:CAGACATCATACCCACGCAC