| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.115726 |
| Chromosome: | chromosome 14 |
| Location: | 3832289 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632750 | (1 of 13) 2.7.11.1//2.7.11.25 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGGATTGTGGCACAGTAGCAATATTGC |
| Internal bar code: | ATTGTCTTTGCCGCGGAAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 619 |
| LEAP-Seq percent confirming: | 99.1394 |
| LEAP-Seq n confirming: | 576 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCCAATGCAACACTACA |
| Suggested primer 2: | AGACCTGTTTGGTCACAGGG |