| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.115884 |
| Chromosome: | chromosome 16 |
| Location: | 4908969 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685650 | GLR1 | Ionotropic glutamate receptor; (1 of 4) PF00060//PF00497 - Ligand-gated ion channel (Lig_chan) // Bacterial extracellular solute-binding proteins, family 3 (SBP_bac_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTCAAGTACCGTTCCCCGCTGGCACAC |
| Internal bar code: | GGAAATACGCAGGACAGGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 906 |
| LEAP-Seq percent confirming: | 98.9463 |
| LEAP-Seq n confirming: | 2911 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTGTCATCGTGTGGTTG |
| Suggested primer 2: | AGGTAGCAGTAGCTGCCCAA |