| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.115899 |
| Chromosome: | chromosome 9 |
| Location: | 5236130 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399552 | LCR1 | Low-CO2 response regulator, Myb-like transcription factor; (1 of 25) IPR001005//IPR009057//IPR017930 - SANT/Myb domain // Homeodomain-like // Myb domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATTACAAGGCCTGGTCCGGACACTGTGA |
| Internal bar code: | GCGTCCAATTACTCTACGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 626 |
| LEAP-Seq percent confirming: | 99.7183 |
| LEAP-Seq n confirming: | 3186 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGCTTCAGTACGGCG |
| Suggested primer 2: | CACGACTGCATGAGAAGGAA |