Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.116083 |
Chromosome: | chromosome 6 |
Location: | 2623735 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269801 | (1 of 2) PTHR10566//PTHR10566:SF45 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCGCCACCCACGTCCCCTGCCCTCAAC |
Internal bar code: | CAGTGTAGCGGACGCGAGTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 285 |
LEAP-Seq percent confirming: | 54.1667 |
LEAP-Seq n confirming: | 143 |
LEAP-Seq n nonconfirming: | 121 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCCACACAAACATCCATT |
Suggested primer 2: | TTTGGGCTGGTTTAGTTTGG |