| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.116085 |
| Chromosome: | chromosome 12 |
| Location: | 5789600 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533351 | CLPB5 | (1 of 3) K03695 - ATP-dependent Clp protease ATP-binding subunit ClpB (clpB); ClpB chaperone, Hsp100 family | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCCGGGACTGGAGCGCCGCTTCCAGCA |
| Internal bar code: | CCTCCCACCCGATTAAGACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 305 |
| LEAP-Seq percent confirming: | 99.2647 |
| LEAP-Seq n confirming: | 810 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACGTCTCCACCCTATCCA |
| Suggested primer 2: | CGCTGTAATTCACTCTGCCA |