Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.116135 |
Chromosome: | chromosome 5 |
Location: | 893502 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g247450 | CGL56,RDP5 | Putative rhodanese-like protein; (1 of 1) PTHR34209//PTHR34209:SF1 - FAMILY NOT NAMED // RHODANESE/CELL CYCLE CONTROL PHOSPHATASE SUPERFAMILY PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCCCCCCCCCTGCTTGACCCTTCCCT |
Internal bar code: | AGGTGACGAGAGTAGGTGGCATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 581 |
LEAP-Seq percent confirming: | 46.6582 |
LEAP-Seq n confirming: | 733 |
LEAP-Seq n nonconfirming: | 838 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATGCAAGGAGGAACCATC |
Suggested primer 2: | AAGAAGTGAAGGCGTAGGCA |